Ribosome profiling reveals downregulation of UMP biosynthesis as the major early response to phage infection.

Bacteria have evolved diverse defense mechanisms to counter bacteriophage attacks. Genetic programs activated upon infection characterize phage-host molecular interactions and ultimately determine the outcome of the infection. In this study, we applied ribosome profiling to monitor protein synthesis during the early stages of sk1 bacteriophage infection in Lactococcus cremoris. Our analysis revealed major changes in gene expression within 5 minutes of sk1 infection. Notably, we observed a specific and severe downregulation of several pyr operons which encode enzymes required for uridine monophosphate biosynthesis. Consistent with previous findings, this is likely an attempt of the host to starve the phage of nucleotides it requires for propagation. We also observed a gene expression response that we expect to benefit the phage. This included the upregulation of 40 ribosome proteins that likely increased the host's translational capacity, concurrent with a downregulation of genes that promote translational fidelity (lepA and raiA). In addition to the characterization of host-phage gene expression responses, the obtained ribosome profiling data enabled us to identify two putative recoding events as well as dozens of loci currently annotated as pseudogenes that are actively translated. Furthermore, our study elucidated alterations in the dynamics of the translation process, as indicated by time-dependent changes in the metagene profile, suggesting global shifts in translation rates upon infection. Additionally, we observed consistent modifications in the ribosome profiles of individual genes, which were apparent as early as 2 minutes post-infection. The study emphasizes our ability to capture rapid alterations of gene expression during phage infection through ribosome profiling. IMPORTANCE: The ribosome profiling technology has provided invaluable insights for understanding cellular translation and eukaryotic viral infections. However, its potential for investigating host-phage interactions remains largely untapped. Here, we applied ribosome profiling to Lactococcus cremoris cultures infected with sk1, a major infectious agent in dairy fermentation processes. This revealed a profound downregulation of genes involved in pyrimidine nucleotide synthesis at an early stage of phage infection, suggesting an anti-phage program aimed at restricting nucleotide availability and, consequently, phage propagation. This is consistent with recent findings and contributes to our growing appreciation for the role of nucleotide limitation as an anti-viral strategy. In addition to capturing rapid alterations in gene expression levels, we identified translation occurring outside annotated regions, as well as signatures of non-standard translation mechanisms. The gene profiles revealed specific changes in ribosomal densities upon infection, reflecting alterations in the dynamics of the translation process.

Mobilization of a diatom mutator-like element (MULE) transposon inactivates the uridine monophosphate synthase (UMPS) locus in Phaeodactylum tricornutum.

Diatoms are photosynthetic unicellular microalgae that drive global ecological phenomena in the biosphere and are emerging as sustainable feedstock for an increasing number of industrial applications. Diatoms exhibit enormous taxonomic and genetic diversity, which often results in peculiar biochemical and biological traits. Transposable elements (TEs) represent a substantial portion of diatom genomes and have been hypothesized to exert a relevant role in enriching genetic diversity and making a core contribution to genome evolution. Here, through long-read whole-genome sequencing, we identified a mutator-like element (MULE) in the model diatom Phaeodactylum tricornutum, and we report the direct observation of its mobilization within the course of a single laboratory experiment. Under selective conditions, this TE inactivated the uridine monophosphate synthase (UMPS) gene of P. tricornutum, one of the few endogenous genetic loci currently targeted for selectable auxotrophy for functional genetics and genome-editing applications. We report the observation of a recently mobilized transposon in diatoms with unique features. These include the combined presence of a MULE transposase with zinc-finger SWIM-type domains and a diatom-specific E3 ubiquitin ligase of the zinc-finger UBR type, which are suggestive of a mobilization mechanism. Our findings provide new elements for the understanding of the role of TEs in diatom genome evolution and in the enrichment of intraspecific genetic variability.

Screening the Thermotoga maritima genome for new wide-spectrum nucleoside and nucleotide kinases.

Enzymes from thermophilic organisms are interesting biocatalysts for a wide variety of applications in organic synthesis, biotechnology, and molecular biology. Next to an increased stability at elevated temperatures, they were described to show a wider substrate spectrum than their mesophilic counterparts. To identify thermostable biocatalysts for the synthesis of nucleotide analogs, we performed a database search on the carbohydrate and nucleotide metabolism of Thermotoga maritima. After expression and purification of 13 enzyme candidates involved in nucleotide synthesis, these enzymes were screened for their substrate scope. We found that the synthesis of 2'-deoxynucleoside 5'-monophosphates (dNMPs) and uridine 5'-monophosphate from nucleosides was catalyzed by the already known wide-spectrum thymidine kinase and the ribokinase. In contrast, no NMP-forming activity was detected for adenosine-specific kinase, uridine kinase, or nucleotidase. The NMP kinases (NMPKs) and the pyruvate-phosphate-dikinase of T. maritima exhibited a rather specific substrate spectrum for the phosphorylation of NMPs, while pyruvate kinase, acetate kinase, and three of the NMPKs showed a broad substrate scope with (2'-deoxy)nucleoside 5'-diphosphates as substrates. Based on these promising results, TmNMPKs were applied in enzymatic cascade reactions for nucleoside 5'-triphosphate synthesis using four modified pyrimidine nucleosides and four purine NMPs as substrates, and we determined that base- and sugar-modified substrates were accepted. In summary, besides the already reported TmTK, NMPKs of T. maritima were identified to be interesting enzyme candidates for the enzymatic production of modified nucleotides.

Impact of Negative Feedbacks on De Novo Pyrimidines Biosynthesis in Escherichia coli.

Earlier studies aimed at investigating the metabolism of endogenous nucleoside triphosphates in synchronous cultures of E. coli cells revealed an auto-oscillatory mode of functioning of the pyrimidine and purine nucleotide biosynthesis system, which the authors associated with the dynamics of cell division. Theoretically, this system has an intrinsic oscillatory potential, since the dynamics of its functioning are controlled through feedback mechanisms. The question of whether the nucleotide biosynthesis system has its own oscillatory circuit is still open. To address this issue, an integral mathematical model of pyrimidine biosynthesis was developed, taking into account all experimentally verified negative feedback in the regulation of enzymatic reactions, the data of which were obtained under in vitro conditions. Analysis of the dynamic modes of the model functioning has shown that in the pyrimidine biosynthesis system, both the steady-state and oscillatory functioning modes can be realized under certain sets of kinetic parameters that fit in the physiological boundaries of the investigated metabolic system. It has been demonstrated that the occurrence of the oscillatory nature of metabolite synthesis depended on the ratio of two parameters: the Hill coefficient, hUMP1-the nonlinearity of the UMP effect on the activity of carbamoyl-phosphate synthetase, and the parameter r characterizing the contribution of the noncompetitive mechanism of UTP inhibition to the regulation of the enzymatic reaction of UMP phosphorylation. Thus, it has been theoretically shown that the E. coli pyrimidine biosynthesis system possesses its own oscillatory circuit whose oscillatory potential depends to a significant degree on the mechanism of regulation of UMP kinase activity.

Human uridine 5'-monophosphate synthase stores metabolic potential in inactive biomolecular condensates.

Human uridine 5'-monophosphate synthase (HsUMPS) is a bifunctional enzyme that catalyzes the final two steps in de novo pyrimidine biosynthesis. The individual orotate phosphoribosyl transferase and orotidine monophosphate domains have been well characterized, but little is known about the overall structure of the protein and how the organization of domains impacts function. Using a combination of chromatography, electron microscopy, and complementary biophysical methods, we report herein that HsUMPS can be observed in two structurally distinct states, an enzymatically active dimeric form and a nonactive multimeric form. These two states readily interconvert to reach an equilibrium that is sensitive to perturbations of the active site and the presence of substrate. We determined that the smaller molecular weight form of HsUMPS is an S-shaped dimer that can self-assemble into relatively well-ordered globular condensates. Our analysis suggests that the transition between dimer and multimer is driven primarily by oligomerization of the orotate phosphoribosyl transferase domain. While the cellular distribution of HsUMPS is unaffected, quantification by mass spectrometry revealed that de novo pyrimidine biosynthesis is dysregulated when this protein is unable to assemble into inactive condensates. Taken together, our data suggest that HsUMPS self-assembles into biomolecular condensates as a means to store metabolic potential for the regulation of metabolic rates.

Non-target metabolomics reveals the changes of small molecular substances in duck breast meat under different preservation time.

Poultry products are an essential animal source of protein for humans. Many factors could destroy the balance of the poultry production chain and cause an overstock of products, which need to be stored in the frozen storage warehouse for a long time. The long-term frozen storage may affect the quality of meat products. In this study, the changes of small molecular substances were revealed in duck meat during long-term storage using non-targeted metabolomics. The results showed that compared with fresh meat, even if the meat is stored under frozen storage conditions, the number of differential metabolites of frozen storage meat continues to increase with the prolongation of storage time, indicating that the meat composition has changed significantly with the storage time increased. With the increase in storage time, the nitrogen-containing small molecular compounds in duck meat increased (carnosine and anserine, aspartic acid, and tyrosine, 1H-indole-3-acetamide, 2-Hydroxyphenethylamine, 2-Naphylamine, allocystathionine, and O-phosphoethanolamine), the nucleotides decomposition process strengthened (IMP and AMP, GMP and UMP), and the content of organic acid increased (5-hydroxy indole acetic acid, 5-hydroxypentanoic acid and phenylacetate, taurine) and carbohydrate (1-O-sinapoyl-beta-d-glucose, 4-O-beta-d-glucopyranosyl-d-mannose, and alpha-d-glucose). These small molecular substances can be used as biomarkers to detect long-term stored duck meat deterioration. KEGG enrichment analysis showed that protein catabolism, nucleotide catabolism, fat decomposition and oxidation, and carbohydrate decomposition were the main metabolic processes of meat deterioration during the long-term storage of duck meat. In addition, Non-target metabolome technology is a powerful tool to reveal the meat deterioration process during long-term storage systematically. This study provided a reference for optimizing domestic poultry meat storage methods and ensuring food safety.

TENT2, TUT4, and TUT7 selectively regulate miRNA sequence and abundance.

TENTs generate miRNA isoforms by 3' tailing. However, little is known about how tailing regulates miRNA function. Here, we generate isogenic HEK293T cell lines in which TENT2, TUT4 and TUT7 are knocked out individually or in combination. Together with rescue experiments, we characterize TENT-specific effects by deep sequencing, Northern blot and in vitro assays. We find that 3' tailing is not random but highly specific. In addition to its known adenylation, TENT2 contributes to guanylation and uridylation on mature miRNAs. TUT4 uridylates most miRNAs whereas TUT7 is dispensable. Removing adenylation has a marginal impact on miRNA levels. By contrast, abolishing uridylation leads to dysregulation of a set of miRNAs. Besides let-7, miR-181b and miR-222 are negatively regulated by TUT4/7 via distinct mechanisms while the miR-888 cluster is upregulated specifically by TUT7. Our results uncover the selective actions of TENTs in generating 3' isomiRs and pave the way to investigate their functions.

Kinetic and Mechanistic Studies of the Terminal Uridylyltransferase, Zcchc11 (TUT4).

Zcchc11 (TUT4, TENT3A, Z11) is a nucleotidyltransferase that catalyzes the 3'-polyuridylation of RNA. Our interest in this enzyme stems from its role in blocking the biogenesis of let-7, a family of microRNAs whose members act as tumor suppressors. Z11 polyuridylates pre-let-7, the precursor of let-7, when pre-let-7 is complexed with LIN28, an RNA-binding protein. Polyuridylation of pre-let-7 marks it for degradation. In addition to this LIN28-dependent activity, Z11 also has LIN28-independent activities. In this paper, we report the results of experiments that characterize LIN28-independent activities of Z11. Significant observations include the following. (1) Z11 uridylates not only mature let-7 species but also substrates as small as dinucleotides. (2) For both let-7i and the diribonucleotide AG, Z11 follows a steady-state ordered mechanism, with UTP adding before RNA. (3) Uridylation kinetics of let-7i (UGAGGUAGUAGUUUGUGCUGUU) and two truncated derivatives, GCUGUU and UU, indicate that Z11 manifests selectivity in Km,RNA; kcat,RNA values for the three substrates are nearly identical. (4) Z11 preferentially uridylates RNA lacking base-pairing near the 3' terminus. (5) Selectivity of Z11 toward ribonucleoside triphosphates is similar for let-7i and AG, with XTP preference: UTP > CTP > ATP ≫ GTP. Selectivity is manifested in Km,XTP, with kcat,XTP values being similar for UTP, CTP, and ATP. (6) Kinetic parameters for RNA turnover are dependent on the structure of the nucleoside triphosphate, consistent with recent structural data indicating stacking of the nucleoside triphosphate base with the base of the 3'-nucleotide of the substrate RNA (Faehnle et al., Nat. Struct. Mol. Biol. 2017, 24, 658).

Protein-Ribofuranosyl Interactions Activate Orotidine 5'-Monophosphate Decarboxylase for Catalysis.

The role of a global, substrate-driven, enzyme conformational change in enabling the extraordinarily large rate acceleration for orotidine 5'-monophosphate decarboxylase (OMPDC)-catalyzed decarboxylation of orotidine 5'-monophosphate (OMP) is examined in experiments that focus on the interactions between OMPDC and the ribosyl hydroxyl groups of OMP. The D37 and T100' side chains of OMPDC interact, respectively, with the C-3' and C-2' hydroxyl groups of enzyme-bound OMP. D37G and T100'A substitutions result in 1.4 kcal/mol increases in the activation barrier ΔG⧧ for catalysis of decarboxylation of the phosphodianion-truncated substrate 1-(ß-d-erythrofuranosyl)orotic acid (EO) but result in larger 2.1-2.9 kcal/mol increases in ΔG⧧ for decarboxylation of OMP and for phosphite dianion-activated decarboxylation of EO. This shows that these substitutions reduce transition-state stabilization by the Q215, Y217, and R235 side chains at the dianion binding site. The D37G and T100'A substitutions result in <1.0 kcal/mol increases in ΔG⧧ for activation of OMPDC-catalyzed decarboxylation of the phosphoribofuranosyl-truncated substrate FO by phosphite dianions. Experiments to probe the effect of D37 and T100' substitutions on the kinetic parameters for d-glycerol 3-phosphate and d-erythritol 4-phosphate activators of OMPDC-catalyzed decarboxylation of FO show that ΔG⧧ for sugar phosphate-activated reactions is increased by ca. 2.5 kcal/mol for each -OH interaction eliminated by D37G or T100'A substitutions. We conclude that the interactions between the D37 and T100' side chains and ribosyl or ribosyl-like hydroxyl groups are utilized to activate OMPDC for catalysis of decarboxylation of OMP, EO, and FO.

Cyclic CMP and cyclic UMP mediate bacterial immunity against phages.

The cyclic pyrimidines 3',5'-cyclic cytidine monophosphate (cCMP) and 3',5'-cyclic uridine monophosphate (cUMP) have been reported in multiple organisms and cell types. As opposed to the cyclic nucleotides 3',5'-cyclic adenosine monophosphate (cAMP) and 3',5'-cyclic guanosine monophosphate (cGMP), which are second messenger molecules with well-established regulatory roles across all domains of life, the biological role of cyclic pyrimidines has remained unclear. Here we report that cCMP and cUMP are second messengers functioning in bacterial immunity against viruses. We discovered a family of bacterial pyrimidine cyclase enzymes that specifically synthesize cCMP and cUMP following phage infection and demonstrate that these molecules activate immune effectors that execute an antiviral response. A crystal structure of a uridylate cyclase enzyme from this family explains the molecular mechanism of selectivity for pyrimidines as cyclization substrates. Defense systems encoding pyrimidine cyclases, denoted here Pycsar (pyrimidine cyclase system for antiphage resistance), are widespread in prokaryotes. Our results assign clear biological function to cCMP and cUMP as immunity signaling molecules in bacteria.

Screening by deep sequencing reveals mediators of microRNA tailing in C. elegans.

microRNAs are frequently modified by addition of untemplated nucleotides to the 3' end, but the role of this tailing is often unclear. Here we characterize the prevalence and functional consequences of microRNA tailing in vivo, using Caenorhabditis elegans. MicroRNA tailing in C. elegans consists mostly of mono-uridylation of mature microRNA species, with rarer mono-adenylation which is likely added to microRNA precursors. Through a targeted RNAi screen, we discover that the TUT4/TUT7 gene family member CID-1/CDE-1/PUP-1 is required for uridylation, whereas the GLD2 gene family member F31C3.2-here named GLD-2-related 2 (GLDR-2)-is required for adenylation. Thus, the TUT4/TUT7 and GLD2 gene families have broadly conserved roles in miRNA modification. We specifically examine the role of tailing in microRNA turnover. We determine half-lives of microRNAs after acute inactivation of microRNA biogenesis, revealing that half-lives are generally long (median = 20.7 h), as observed in other systems. Although we observe that the proportion of tailed species increases over time after biogenesis, disrupting tailing does not alter microRNA decay. Thus, tailing is not a global regulator of decay in C. elegans. Nonetheless, by identifying the responsible enzymes, this study lays the groundwork to explore whether tailing plays more specialized context- or miRNA-specific regulatory roles.

The mystery of sub-picosecond charge transfer following irradiation of hydrated uridine monophosphate.

The early mechanisms by which ionizing rays damage biological structures by so-called direct effects are largely elusive. In a recent picosecond pulse radiolysis study of concentrated uridine monophosphate solutions [J. Ma, S. A. Denisov, J.-L. Marignier, P. Pernot, A. Adhikary, S. Seki and M. Mostafavi, J. Phys. Chem. Lett., 2018, 9, 5105], unexpected results were found regarding the oxidation of the nucleobase. The signature of the oxidized nucleobase could not be detected 5 ps after the electron pulse, but only the oxidized phosphate, raising intriguing questions about the identity of charge-transfer mechanisms that could explain the absence of U+. We address here this question by means of advanced first-principles atomistic simulations of solvated uridine monophosphate, combining Density Functional Theory (DFT) with polarizable embedding schemes. We contrast three very distinct mechanisms of charge transfer covering the atto-, femto- and pico-second timescales. We first investigate the ionization mechanism and subsequent hole/charge migrations on a timescale of attoseconds to a few femtoseconds under the frozen nuclei approximation. We then consider a nuclear-driven phosphate-to-oxidized-nucleobase electron transfer, showing that it is an uncompetitive reaction channel on the sub-picosecond timescale, despite its high exothermicity and significant electronic coupling. Finally, we show that non-adiabatic charge transfer is enabled by femtosecond nuclear relaxation after ionization. We show that electronic decoherence and the electronic coupling strength are the key parameters that determine the hopping probabilities. Our results provide important insight into the interplay between electronics and nuclear motions in the early stages of the multiscale responses of biological matter subjected to ionizing radiation.

Single Diastereomers of the Clinical Anticancer ProTide Agents NUC-1031 and NUC-3373 Preferentially Target Cancer Stem Cells In Vitro.

A 3'-protected route toward the synthesis of the diastereomers of clinically active ProTides, NUC-1031 and NUC-3373, is described. The in vitro cytotoxic activities of the individual diastereomers were found to be similar to their diastereomeric mixtures. In the KG1a cell line, NUC-1031 and NUC-3373 have preferential cytotoxic effects on leukemic stem cells (LSCs). These effects were not diastereomer-specific and were not observed with the parental nucleoside analogues gemcitabine and FUDR, respectively. In addition, NUC-1031 preferentially targeted LSCs in primary AML samples and cancer stem cells in the prostate cancer cell line, LNCaP. Although the mechanism for this remains incompletely resolved, NUC-1031-treated cells showed increased levels of triphosphate in both LSC and bulk tumor fractions. As ProTides are not dependent on nucleoside transporters, it seems possible that the LSC targeting observed with ProTides may be caused, at least in part, by preferential accumulation of metabolized nucleos(t)ide analogues.

Terminal uridyltransferase 7 regulates TLR4-triggered inflammation by controlling Regnase-1 mRNA uridylation and degradation.

Different levels of regulatory mechanisms, including posttranscriptional regulation, are needed to elaborately regulate inflammatory responses to prevent harmful effects. Terminal uridyltransferase 7 (TUT7) controls RNA stability by adding uridines to its 3' ends, but its function in innate immune response remains obscure. Here we reveal that TLR4 activation induces TUT7, which in turn selectively regulates the production of a subset of cytokines, including Interleukin 6 (IL-6). TUT7 regulates IL-6 expression by controlling ribonuclease Regnase-1 mRNA (encoded by Zc3h12a gene) stability. Mechanistically, TLR4 activation causes TUT7 to bind directly to the stem-loop structure on Zc3h12a 3'-UTR, thereby promotes Zc3h12a uridylation and degradation. Zc3h12a from LPS-treated TUT7-sufficient macrophages possesses increased oligo-uridylated ends with shorter poly(A) tails, whereas oligo-uridylated Zc3h12a is significantly reduced in Tut7-/- cells after TLR4 activation. Together, our findings reveal the functional role of TUT7 in sculpting TLR4-driven responses by modulating mRNA stability of a selected set of inflammatory mediators.

siRNA potency enhancement via chemical modifications of nucleotide bases at the 5'-end of the siRNA guide strand.

Small interfering RNAs (siRNAs) can be utilized not only as functional biological research tools but also as therapeutic agents. For the clinical use of siRNA as drugs, various chemical modifications have been used to improve the activity of siRNA drugs, and further chemical modifications are expected to improve the utility of siRNA therapeutics. As the 5' nucleobase of the guide strand affects the interaction between an siRNA and AGO2 and target cleavage activity, structural optimization of this specific position may be a useful strategy for improving siRNA activity. Here, using the in silico model of the complex between human AGO2 MID domain and nucleoside monophosphates, we screened and synthesized an original adenine-derived analog, 6-(3-(2-carboxyethyl)phenyl)purine (6-mCEPh-purine), that fits better than the natural nucleotide bases into the MID domain of AGO2. Introduction of the 6-mCEPh-purine analog at the 5'-end of the siRNA guide strand significantly enhanced target knockdown activity in both cultured cell lines and in vivo animal models. Our findings can help expand strategies for rationally optimizing siRNA activity via chemical modifications of nucleotide bases.

The YdiU Domain Modulates Bacterial Stress Signaling through Mn2+-Dependent UMPylation.

Sensing stressful conditions and adjusting the cellular metabolism to adapt to the environment are essential activities for bacteria to survive in variable situations. Here, we describe a stress-related protein, YdiU, and characterize YdiU as an enzyme that catalyzes the covalent attachment of uridine-5'-monophosphate to a protein tyrosine/histidine residue, an unusual modification defined as UMPylation. Mn2+ serves as an essential co-factor for YdiU-mediated UMPylation. UTP and Mn2+ binding converts YdiU to an aggregate-prone state facilitating the recruitment of chaperones. The UMPylation of chaperones prevents them from binding co-factors or clients, thereby impairing their function. Consistent with the recent finding that YdiU acts as an AMPylator, we further demonstrate that the self-AMPylation of YdiU padlocks its chaperone-UMPylation activity. A detailed mechanism is proposed based on the crystal structures of Apo-YdiU and YdiU-AMPNPP-Mn2+ and on molecular dynamics simulation models of YdiU-UTP-Mn2+ and YdiU-UTP-peptide. In vivo data demonstrate that YdiU effectively protects Salmonella from stress-induced ATP depletion through UMPylation.

Orotidine 5'-Monophosphate Decarboxylase: The Operation of Active Site Chains Within and Across Protein Subunits.

The D37 and T100' side chains of orotidine 5'-monophosphate decarboxylase (OMPDC) interact with the C-3' and C-2' ribosyl hydroxyl groups, respectively, of the bound substrate. We compare the intra-subunit interactions of D37 with the inter-subunit interactions of T100' by determining the effects of the D37G, D37A, T100'G, and T100'A substitutions on the following: (a) kcat and kcat/Km values for the OMPDC-catalyzed decarboxylations of OMP and 5-fluoroorotidine 5'-monophosphate (FOMP) and (b) the stability of dimeric OMPDC relative to the monomer. The D37G and T100'A substitutions resulted in 2 kcal mol-1 increases in ΔG† for kcat/Km for the decarboxylation of OMP, while the D37A and T100'G substitutions resulted in larger 4 and 5 kcal mol-1 increases, respectively, in ΔG†. The D37G and T100'A substitutions both resulted in smaller 2 kcal mol-1 decreases in ΔG† for the decarboxylation of FOMP compared to that of OMP. These results show that the D37G and T100'A substitutions affect the barrier to the chemical decarboxylation step while the D37A and T100'G substitutions also affect the barrier to a slow, ligand-driven enzyme conformational change. Substrate binding induces the movement of an α-helix (G'98-S'106) toward the substrate C-2' ribosyl hydroxy bound at the main subunit. The T100'G substitution destabilizes the enzyme dimer by 3.5 kcal mol-1 compared to the monomer, which is consistent with the known destabilization of α-helices by the internal Gly side chains [Serrano, L., et al. (1992) Nature, 356, 453-455]. We propose that the T100'G substitution weakens the α-helical contacts at the dimer interface, which results in a decrease in the dimer stability and an increase in the barrier to the ligand-driven conformational change.

The Perlman syndrome DIS3L2 exoribonuclease safeguards endoplasmic reticulum-targeted mRNA translation and calcium ion homeostasis.

DIS3L2-mediated decay (DMD) is a surveillance pathway for certain non-coding RNAs (ncRNAs) including ribosomal RNAs (rRNAs), transfer RNAs (tRNAs), small nuclear RNAs (snRNAs), and RMRP. While mutations in DIS3L2 are associated with Perlman syndrome, the biological significance of impaired DMD is obscure and pathological RNAs have not been identified. Here, by ribosome profiling (Ribo-seq) we find specific dysregulation of endoplasmic reticulum (ER)-targeted mRNA translation in DIS3L2-deficient cells. Mechanistically, DMD functions in the quality control of the 7SL ncRNA component of the signal recognition particle (SRP) required for ER-targeted translation. Upon DIS3L2 loss, sustained 3'-end uridylation of aberrant 7SL RNA impacts ER-targeted translation and causes ER calcium leakage. Consequently, elevated intracellular calcium in DIS3L2-deficient cells activates calcium signaling response genes and perturbs ESC differentiation. Thus, DMD is required to safeguard ER-targeted mRNA translation, intracellular calcium homeostasis, and stem cell differentiation.

Detecting Protein-Ligand Interaction from Integrated Transient Induced Molecular Electronic Signal (i-TIMES).

Quantitative information about protein-ligand interactions is central to drug discovery. To obtain the quintessential reaction dissociation constant, ideally measurements of reactions should be performed without perturbations by molecular labeling or immobilization. The technique of transient induced molecular electrical signal (TIMES) has provided a promising technique to meet such requirements, and its performance in a microfluidic environment further offers the potential for high throughput and reduced consumption of reagents. In this work, we further the development by using integrated TIMES signal (i-TIMES) to greatly enhance the accuracy and reproducibility of the measurement. While the transient response may be of interest, the integrated signal directly measures the total amount of surface charge density resulted from molecules near the surface of electrode. The signals enable quantitative characterization of protein-ligand interactions. We have demonstrated the feasibility of i-TIMES technique using different biomolecules including lysozyme, N,N',N″-triacetylchitotriose (TriNAG), aptamer, p-aminobenzamidine (pABA), bovine pancreatic ribonuclease A (RNaseA), and uridine-3'-phosphate (3'UMP). The results show i-TIMES is a simple and accurate technique that can bring tremendous value to drug discovery and research of intermolecular interactions.

Functional diversity of small nucleolar RNAs.

Small nucleolar RNAs (snoRNAs) are short non-protein-coding RNAs with a long-recognized role in tuning ribosomal and spliceosomal function by guiding ribose methylation and pseudouridylation at targeted nucleotide residues of ribosomal and small nuclear RNAs, respectively. SnoRNAs are increasingly being implicated in regulation of new types of post-transcriptional processes, for example rRNA acetylation, modulation of splicing patterns, control of mRNA abundance and translational efficiency, or they themselves are processed to shorter stable RNA species that seem to be the principal or alternative bioactive isoform. Intriguingly, some display unusual cellular localization under exogenous stimuli, or tissue-specific distribution. Here, we discuss the new and unforeseen roles attributed to snoRNAs, focusing on the presumed mechanisms of action. Furthermore, we review the experimental approaches to study snoRNA function, including high resolution RNA:protein and RNA:RNA interaction mapping, techniques for analyzing modifications on targeted RNAs, and cellular and animal models used in snoRNA biology research.